Review




Structured Review

Synthego Inc b2m single guide rna
B2m Single Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b2m+single-guide+rna/us12377147-639-18-26?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
b2m single guide rna - by Bioz Stars, 2026-08
86/100 stars

Images



Similar Products

86
Synthego Inc b2m single guide rna
B2m Single Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b2m+single-guide+rna/us12377147-639-18-26?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
b2m single guide rna - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

90
OriGene b2m single guide rna plasmid
B2m Single Guide Rna Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b2m+single-guide+rna/pm36165170-62-2-12?v=OriGene
Average 90 stars, based on 1 article reviews
b2m single guide rna plasmid - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Synthego Inc b2m single-guide rna
( A ) Scheme of retroviral vectors containing the survivin-specific TCR (top, TCR) or the combination of TCR and CD8αβ and the selectable marker gene ΔCD271 (bottom, TCR8). ( B and C ) Determination of monomeric dissociation kinetics with survivin-specific reversible NTAmers. ( B ) Representative analysis of temperature-controlled (4°C) pMHC-TCR or pMHC-TCR8 monomeric dissociation rates. No NTAmer staining in TCR + CD4 + T cells; ND, not detected. ( C ) Summary of monomeric dissociation constants [ k off (s −1 )], n = 3 donors, three independent experiments with technical replicates. Mean ± SD, P = NS, one-way analysis of variance (ANOVA) test. ( D and E ) Analysis of early TCR signaling events. ( D ) Representative FACS histograms of pLCK-Y394 phosphorylation NT (gray), TCR + (blue), and TCR8 + (green) CD4 + or CD8 + T cells. ( E ) Summary of pLCK MFI normalized to MFI in NT control cells. n = 4 donors, mean ± SD, CD4: TCR + versus TCR8 + : 104 ± 11% versus 173 ± 35%, CD8: TCR + versus TCR8 + : 106 ± 7% versus 126 ± 13%, TCR8 + CD8 versus CD4: 126 ± 13% versus 173 ± 35%. NS, not significant, * P < 0.05. ( F ) Antigen sensitivity measured by IFN-γ ELISpot against peptide-pulsed T2 cells. SFC, spot-forming cells, n = 3 donors, three technical replicates each, mean ± SD, nonlinear regression (curve fit). ( G ) Coculture of NT, TCR + , or TCR8 + CD4 + (red bars) or CD8 + (black bars) T cells with BV173 leukemia cells (HLA-A2*02:01 + survivin + ); E:T ratio 1:5, residual BV173 cells quantified on day 3, n = 7. ( H ) Coculture of NT, TCR + , or TCR8 + CD4 + (left) or CD8 + (right) T cells with wild-type (WT) BV173 (solid bars) or β2-microglobulin knockout <t>(B2M-KO)</t> BV173 cells (open bars); E:T ratio 1:5, residual BV173 cells quantified on day 3, n = 3. Mean ± SD, *** P < 0.001 and **** P < 0.0001. t test on log-transformed data.
B2m Single Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b2m+single-guide+rna/pmc07455496-185-3-7?v=Synthego+Inc
Average 90 stars, based on 1 article reviews
b2m single-guide rna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


( A ) Scheme of retroviral vectors containing the survivin-specific TCR (top, TCR) or the combination of TCR and CD8αβ and the selectable marker gene ΔCD271 (bottom, TCR8). ( B and C ) Determination of monomeric dissociation kinetics with survivin-specific reversible NTAmers. ( B ) Representative analysis of temperature-controlled (4°C) pMHC-TCR or pMHC-TCR8 monomeric dissociation rates. No NTAmer staining in TCR + CD4 + T cells; ND, not detected. ( C ) Summary of monomeric dissociation constants [ k off (s −1 )], n = 3 donors, three independent experiments with technical replicates. Mean ± SD, P = NS, one-way analysis of variance (ANOVA) test. ( D and E ) Analysis of early TCR signaling events. ( D ) Representative FACS histograms of pLCK-Y394 phosphorylation NT (gray), TCR + (blue), and TCR8 + (green) CD4 + or CD8 + T cells. ( E ) Summary of pLCK MFI normalized to MFI in NT control cells. n = 4 donors, mean ± SD, CD4: TCR + versus TCR8 + : 104 ± 11% versus 173 ± 35%, CD8: TCR + versus TCR8 + : 106 ± 7% versus 126 ± 13%, TCR8 + CD8 versus CD4: 126 ± 13% versus 173 ± 35%. NS, not significant, * P < 0.05. ( F ) Antigen sensitivity measured by IFN-γ ELISpot against peptide-pulsed T2 cells. SFC, spot-forming cells, n = 3 donors, three technical replicates each, mean ± SD, nonlinear regression (curve fit). ( G ) Coculture of NT, TCR + , or TCR8 + CD4 + (red bars) or CD8 + (black bars) T cells with BV173 leukemia cells (HLA-A2*02:01 + survivin + ); E:T ratio 1:5, residual BV173 cells quantified on day 3, n = 7. ( H ) Coculture of NT, TCR + , or TCR8 + CD4 + (left) or CD8 + (right) T cells with wild-type (WT) BV173 (solid bars) or β2-microglobulin knockout (B2M-KO) BV173 cells (open bars); E:T ratio 1:5, residual BV173 cells quantified on day 3, n = 3. Mean ± SD, *** P < 0.001 and **** P < 0.0001. t test on log-transformed data.

Journal: Science Advances

Article Title: Single-cell transcriptomics identifies multiple pathways underlying antitumor function of TCR- and CD8αβ-engineered human CD4 + T cells

doi: 10.1126/sciadv.aaz7809

Figure Lengend Snippet: ( A ) Scheme of retroviral vectors containing the survivin-specific TCR (top, TCR) or the combination of TCR and CD8αβ and the selectable marker gene ΔCD271 (bottom, TCR8). ( B and C ) Determination of monomeric dissociation kinetics with survivin-specific reversible NTAmers. ( B ) Representative analysis of temperature-controlled (4°C) pMHC-TCR or pMHC-TCR8 monomeric dissociation rates. No NTAmer staining in TCR + CD4 + T cells; ND, not detected. ( C ) Summary of monomeric dissociation constants [ k off (s −1 )], n = 3 donors, three independent experiments with technical replicates. Mean ± SD, P = NS, one-way analysis of variance (ANOVA) test. ( D and E ) Analysis of early TCR signaling events. ( D ) Representative FACS histograms of pLCK-Y394 phosphorylation NT (gray), TCR + (blue), and TCR8 + (green) CD4 + or CD8 + T cells. ( E ) Summary of pLCK MFI normalized to MFI in NT control cells. n = 4 donors, mean ± SD, CD4: TCR + versus TCR8 + : 104 ± 11% versus 173 ± 35%, CD8: TCR + versus TCR8 + : 106 ± 7% versus 126 ± 13%, TCR8 + CD8 versus CD4: 126 ± 13% versus 173 ± 35%. NS, not significant, * P < 0.05. ( F ) Antigen sensitivity measured by IFN-γ ELISpot against peptide-pulsed T2 cells. SFC, spot-forming cells, n = 3 donors, three technical replicates each, mean ± SD, nonlinear regression (curve fit). ( G ) Coculture of NT, TCR + , or TCR8 + CD4 + (red bars) or CD8 + (black bars) T cells with BV173 leukemia cells (HLA-A2*02:01 + survivin + ); E:T ratio 1:5, residual BV173 cells quantified on day 3, n = 7. ( H ) Coculture of NT, TCR + , or TCR8 + CD4 + (left) or CD8 + (right) T cells with wild-type (WT) BV173 (solid bars) or β2-microglobulin knockout (B2M-KO) BV173 cells (open bars); E:T ratio 1:5, residual BV173 cells quantified on day 3, n = 3. Mean ± SD, *** P < 0.001 and **** P < 0.0001. t test on log-transformed data.

Article Snippet: In brief, a B2M single-guide RNA (5′–GGCCACGGAGCGAGACAUCU–3′, Synthego) and recombinant Cas9 protein (CP01 and PNA Bio), 1 μg each, were mixed at room temperature and used to electroporate 0.15 × 10 6 BV173 cells (three pulses of 1600 V for 10 ms, Neon Transfection System, Invitrogen).

Techniques: Retroviral, Marker, Staining, Phospho-proteomics, Control, Enzyme-linked Immunospot, Knock-Out, Transformation Assay